ID: 998058670_998058675

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 998058670 998058675
Species Human (GRCh38) Human (GRCh38)
Location 5:139101703-139101725 5:139101742-139101764
Sequence CCATTTGATTCTGGGTTAGACAC AATAACTGCTTGCTATCAAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!