ID: 998080853_998080864

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 998080853 998080864
Species Human (GRCh38) Human (GRCh38)
Location 5:139274038-139274060 5:139274057-139274079
Sequence CCCGCCCACCGAAGCCACGCCCA CCCAGTAGCCGCCCCGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 231} {0: 1, 1: 0, 2: 0, 3: 18, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!