ID: 998086136_998086141

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 998086136 998086141
Species Human (GRCh38) Human (GRCh38)
Location 5:139325218-139325240 5:139325237-139325259
Sequence CCGTTTCCCTTCAAGTAAAGCAG GCAGACAGAAGGGATGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 246} {0: 1, 1: 0, 2: 2, 3: 32, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!