ID: 998093433_998093441

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998093433 998093441
Species Human (GRCh38) Human (GRCh38)
Location 5:139383882-139383904 5:139383897-139383919
Sequence CCTCACCACCCTGCACCCCTCAG CCCCTCAGGGTCCCTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 713} {0: 1, 1: 0, 2: 3, 3: 29, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!