ID: 998104964_998104976

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 998104964 998104976
Species Human (GRCh38) Human (GRCh38)
Location 5:139462627-139462649 5:139462668-139462690
Sequence CCCAGGATCACCCAGCACAGCTG CATGTCAGCTGGGTATGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 333} {0: 1, 1: 0, 2: 0, 3: 20, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!