ID: 998104964_998104978

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 998104964 998104978
Species Human (GRCh38) Human (GRCh38)
Location 5:139462627-139462649 5:139462673-139462695
Sequence CCCAGGATCACCCAGCACAGCTG CAGCTGGGTATGTGGCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 333} {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!