ID: 998116713_998116726

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 998116713 998116726
Species Human (GRCh38) Human (GRCh38)
Location 5:139543421-139543443 5:139543471-139543493
Sequence CCTTCCGTGGGCCCAGCTTCCCT CGTCAGTAGGCGGGCTGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 272} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!