ID: 998130396_998130411

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 998130396 998130411
Species Human (GRCh38) Human (GRCh38)
Location 5:139648776-139648798 5:139648796-139648818
Sequence CCTGCCCCGCCCCTCCCCCTCGG CGGCCTCGCGGCGACGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 29, 3: 295, 4: 2113} {0: 1, 1: 1, 2: 3, 3: 44, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!