ID: 998136522_998136539

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 998136522 998136539
Species Human (GRCh38) Human (GRCh38)
Location 5:139677031-139677053 5:139677077-139677099
Sequence CCCGGCTGGCCGGCTCCTGCATG GACCGCGGCTGGCGGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 302} {0: 1, 1: 0, 2: 1, 3: 47, 4: 884}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!