ID: 998153532_998153546

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 998153532 998153546
Species Human (GRCh38) Human (GRCh38)
Location 5:139771213-139771235 5:139771262-139771284
Sequence CCCGGGTGGCGGAGTCTCTATTT ACCCGGGGCTGCCCCACCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!