ID: 998163758_998163761

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 998163758 998163761
Species Human (GRCh38) Human (GRCh38)
Location 5:139828658-139828680 5:139828675-139828697
Sequence CCTGCCTCATCCTGCTTCTGAAA CTGAAATGACCCTTAAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 775} {0: 1, 1: 1, 2: 0, 3: 19, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!