|
Left Crispr |
Right Crispr |
| Crispr ID |
998165626 |
998165629 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:139841413-139841435
|
5:139841456-139841478
|
| Sequence |
CCATCAATGAACACTTGGCTTAC |
GAAAAATGCTGTTATGAAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 13, 3: 59, 4: 323} |
{0: 1, 1: 3, 2: 57, 3: 538, 4: 2111} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|