ID: 998224764_998224768

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 998224764 998224768
Species Human (GRCh38) Human (GRCh38)
Location 5:140318387-140318409 5:140318427-140318449
Sequence CCTTCAGCAAAGAGAGTATCAGT AGAAAAGAGGTCTCTGCATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 15, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!