ID: 998282366_998282370

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998282366 998282370
Species Human (GRCh38) Human (GRCh38)
Location 5:140823743-140823765 5:140823758-140823780
Sequence CCCGCTGACAGCCACAGCCACAG AGCCACAGTGCTGGTGTCGCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 8, 3: 50, 4: 444} {0: 1, 1: 1, 2: 4, 3: 20, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!