ID: 998282526_998282534

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 998282526 998282534
Species Human (GRCh38) Human (GRCh38)
Location 5:140825516-140825538 5:140825563-140825585
Sequence CCAGGTTCAAGCGATTCTCCTGC TACAGGCATGTGCCCACACCTGG
Strand - +
Off-target summary {0: 41236, 1: 112059, 2: 146946, 3: 86404, 4: 46144} {0: 2, 1: 4, 2: 27, 3: 182, 4: 682}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!