|
Left Crispr |
Right Crispr |
Crispr ID |
998282527 |
998282534 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:140825534-140825556
|
5:140825563-140825585
|
Sequence |
CCTGCCTTATCTTCCCAAGTAGC |
TACAGGCATGTGCCCACACCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 185, 2: 6845, 3: 93598, 4: 196449} |
{0: 2, 1: 4, 2: 27, 3: 182, 4: 682} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|