ID: 998316576_998316585

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 998316576 998316585
Species Human (GRCh38) Human (GRCh38)
Location 5:141188661-141188683 5:141188680-141188702
Sequence CCCCCGCCTTCACCCAAACCTCC CTCCTACACCCTGTTCGTCCGGG
Strand - +
Off-target summary {0: 9, 1: 4, 2: 3, 3: 22, 4: 447} {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!