ID: 998334075_998334085

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 998334075 998334085
Species Human (GRCh38) Human (GRCh38)
Location 5:141355427-141355449 5:141355455-141355477
Sequence CCCTGAACCCGCGCAGCGGCACC CACCGCGGGTAGGATAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 59} {0: 1, 1: 1, 2: 2, 3: 8, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!