ID: 998342528_998342539

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 998342528 998342539
Species Human (GRCh38) Human (GRCh38)
Location 5:141430987-141431009 5:141431030-141431052
Sequence CCTGAATCCGCGCAGCGGCAGCT GACCGGGAGGAGCTCTGTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 1, 4: 50} {0: 1, 1: 0, 2: 0, 3: 6, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!