ID: 998352658_998352668

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 998352658 998352668
Species Human (GRCh38) Human (GRCh38)
Location 5:141511527-141511549 5:141511552-141511574
Sequence CCTCCTCCCCACCCCACTCCAAC TTCCTCTTTCCCGAGTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 46, 3: 397, 4: 2619} {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!