ID: 998352662_998352668

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 998352662 998352668
Species Human (GRCh38) Human (GRCh38)
Location 5:141511535-141511557 5:141511552-141511574
Sequence CCACCCCACTCCAACAGTTCCTC TTCCTCTTTCCCGAGTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 388} {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!