ID: 998375760_998375768 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 998375760 | 998375768 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:141689525-141689547 | 5:141689572-141689594 |
| Sequence | CCATTTCTCATGCCACTGAGATC | GACTTCTATGCCACCCTACAGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 16, 4: 221} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||