ID: 998397332_998397341 |
View in Genome Browser |
Spacer: 27 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 998397332 | 998397341 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:141827100-141827122 | 5:141827150-141827172 |
Sequence | CCTGAGTTCACTCTTGCCTCGTG | GACATTGAGGAAGACAGGACAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 1, 2: 2, 3: 28, 4: 374} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |