ID: 998397332_998397341

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 998397332 998397341
Species Human (GRCh38) Human (GRCh38)
Location 5:141827100-141827122 5:141827150-141827172
Sequence CCTGAGTTCACTCTTGCCTCGTG GACATTGAGGAAGACAGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 28, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!