ID: 998404922_998404930

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 998404922 998404930
Species Human (GRCh38) Human (GRCh38)
Location 5:141868879-141868901 5:141868918-141868940
Sequence CCAGCATCACGGTCTGAAGCCAG GAGCCGATGTTGGTGTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 122} {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!