ID: 998406265_998406282

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 998406265 998406282
Species Human (GRCh38) Human (GRCh38)
Location 5:141876354-141876376 5:141876394-141876416
Sequence CCGCAAGCCGGAGCCGGCGCGAG GGAGGGGGCGGGGAGGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65} {0: 1, 1: 1, 2: 82, 3: 758, 4: 5182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!