ID: 998417805_998417810

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 998417805 998417810
Species Human (GRCh38) Human (GRCh38)
Location 5:141958279-141958301 5:141958316-141958338
Sequence CCAATTAGAGAAAGAGCATTTCC GCCTGCCGCTGAGGAGGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199} {0: 1, 1: 1, 2: 1, 3: 26, 4: 677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!