ID: 998419811_998419814

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 998419811 998419814
Species Human (GRCh38) Human (GRCh38)
Location 5:141973532-141973554 5:141973561-141973583
Sequence CCGGCCAGCCTCTGTGCATTTTC TAACTGATTTTAATGTTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 336} {0: 1, 1: 0, 2: 2, 3: 56, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!