ID: 998420213_998420216

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 998420213 998420216
Species Human (GRCh38) Human (GRCh38)
Location 5:141978398-141978420 5:141978445-141978467
Sequence CCTAGCATACTTGAATATTGTCT CTCAGAAAAAAGTGCAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150} {0: 1, 1: 0, 2: 4, 3: 57, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!