ID: 998422616_998422627

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 998422616 998422627
Species Human (GRCh38) Human (GRCh38)
Location 5:142001422-142001444 5:142001464-142001486
Sequence CCACCCAAATCCACCCCCAGGTT CTGTGAAAGTGGAAGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 267} {0: 1, 1: 0, 2: 7, 3: 51, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!