ID: 998422619_998422627

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 998422619 998422627
Species Human (GRCh38) Human (GRCh38)
Location 5:142001432-142001454 5:142001464-142001486
Sequence CCACCCCCAGGTTCTCCTAGTTC CTGTGAAAGTGGAAGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 238} {0: 1, 1: 0, 2: 7, 3: 51, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!