ID: 998430807_998430811

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 998430807 998430811
Species Human (GRCh38) Human (GRCh38)
Location 5:142068281-142068303 5:142068331-142068353
Sequence CCGTCATAGTTCAGAACAGTCAC TGTTGACTGAAAAAGCAAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 28, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!