ID: 998439151_998439156

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 998439151 998439156
Species Human (GRCh38) Human (GRCh38)
Location 5:142141818-142141840 5:142141838-142141860
Sequence CCTGGCAGGTGTTTAATAAATTG TTGAGGACCTGGGCCAGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!