ID: 998459294_998459305

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 998459294 998459305
Species Human (GRCh38) Human (GRCh38)
Location 5:142297591-142297613 5:142297620-142297642
Sequence CCCTAGAACTCCTCTTCCATTTC CTGTGTCAGGGGTTGGCGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!