ID: 998472853_998472859

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 998472853 998472859
Species Human (GRCh38) Human (GRCh38)
Location 5:142396841-142396863 5:142396868-142396890
Sequence CCAATCAGAGGTGCTTTCCATTT TTTGCAATGCAGAAAGGGGGTGG
Strand - +
Off-target summary {0: 2, 1: 27, 2: 88, 3: 138, 4: 295} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!