ID: 998491479_998491489

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 998491479 998491489
Species Human (GRCh38) Human (GRCh38)
Location 5:142550944-142550966 5:142550985-142551007
Sequence CCGTCCACCTTATCCTTCCAAAG GAGCCACCACTGCAGGCATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 30, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!