ID: 998493652_998493655

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 998493652 998493655
Species Human (GRCh38) Human (GRCh38)
Location 5:142568253-142568275 5:142568283-142568305
Sequence CCAATTCTAGTGTTAGGCTTTCC TAATTAGGAGTCCTGATGAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!