ID: 998498100_998498101

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 998498100 998498101
Species Human (GRCh38) Human (GRCh38)
Location 5:142608353-142608375 5:142608400-142608422
Sequence CCTCATTCAGAAATTGGTGCGGT ATTAAAATGTAGCCACAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75} {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!