ID: 998515480_998515487

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 998515480 998515487
Species Human (GRCh38) Human (GRCh38)
Location 5:142749953-142749975 5:142749972-142749994
Sequence CCCCTCTTGGGTAGTCCTGACTA ACTATCTACAGTATTAAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!