ID: 998520320_998520329

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 998520320 998520329
Species Human (GRCh38) Human (GRCh38)
Location 5:142794341-142794363 5:142794374-142794396
Sequence CCCAGAGGAATACTGGGGTGCTA AGGAGGGGGGACAGAGGCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 8, 3: 88, 4: 952}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!