ID: 998520321_998520325

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 998520321 998520325
Species Human (GRCh38) Human (GRCh38)
Location 5:142794342-142794364 5:142794359-142794381
Sequence CCAGAGGAATACTGGGGTGCTAT TGCTATAAATACAGAAGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 29, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!