ID: 998533126_998533128

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 998533126 998533128
Species Human (GRCh38) Human (GRCh38)
Location 5:142903422-142903444 5:142903441-142903463
Sequence CCTGGAAGGTTGAATGTCCTTTA TTTATCTCATTTTAGATCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125} {0: 1, 1: 2, 2: 4, 3: 60, 4: 595}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!