ID: 998534559_998534564

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 998534559 998534564
Species Human (GRCh38) Human (GRCh38)
Location 5:142917327-142917349 5:142917372-142917394
Sequence CCACACCTGGCCTAAACTTCAGA GATGAGCTCAGAGCTGTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 125, 4: 896} {0: 1, 1: 0, 2: 3, 3: 25, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!