ID: 998534560_998534564

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 998534560 998534564
Species Human (GRCh38) Human (GRCh38)
Location 5:142917332-142917354 5:142917372-142917394
Sequence CCTGGCCTAAACTTCAGATATTT GATGAGCTCAGAGCTGTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 489} {0: 1, 1: 0, 2: 3, 3: 25, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!