ID: 998542763_998542769

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 998542763 998542769
Species Human (GRCh38) Human (GRCh38)
Location 5:142998458-142998480 5:142998497-142998519
Sequence CCTACTGGGCTTAGTCCACTTGG CTGTGTTTGTAAATGTATGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 63, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!