ID: 998557728_998557732

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 998557728 998557732
Species Human (GRCh38) Human (GRCh38)
Location 5:143141975-143141997 5:143141991-143142013
Sequence CCCTTTGCAAAGAAAAGGGTTAT GGGTTATTACAGGTGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 21, 4: 298} {0: 1, 1: 0, 2: 2, 3: 5, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!