ID: 998557766_998557772

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 998557766 998557772
Species Human (GRCh38) Human (GRCh38)
Location 5:143142346-143142368 5:143142387-143142409
Sequence CCAGGCTGCTAGTCTCGAACTCC GCCTCGGCCTCCCAAAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 34, 3: 116, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!