|
Left Crispr |
Right Crispr |
| Crispr ID |
998557766 |
998557774 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:143142346-143142368
|
5:143142388-143142410
|
| Sequence |
CCAGGCTGCTAGTCTCGAACTCC |
CCTCGGCCTCCCAAAGTGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 16, 2: 34, 3: 116, 4: 230} |
{0: 120847, 1: 270445, 2: 211583, 3: 123288, 4: 170743} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|