ID: 998564710_998564715

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 998564710 998564715
Species Human (GRCh38) Human (GRCh38)
Location 5:143206849-143206871 5:143206867-143206889
Sequence CCCTGCCTCAGAACAAGGCTGGT CTGGTGATAGCACGTGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 7, 4: 172} {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!