ID: 998586225_998586229

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 998586225 998586229
Species Human (GRCh38) Human (GRCh38)
Location 5:143430627-143430649 5:143430642-143430664
Sequence CCCTTTCAGCCTCTTGAGGACAG GAGGACAGTGAGAAGACAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 361} {0: 1, 1: 0, 2: 6, 3: 54, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!