ID: 998652408_998652410

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 998652408 998652410
Species Human (GRCh38) Human (GRCh38)
Location 5:144135612-144135634 5:144135630-144135652
Sequence CCAAACTATAATAGGCTCTGGTT TGGTTGGCAAGATCTTAAATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!